Piezo1 contributes to alveolar bone remodeling by activating β-catenin under compressive stress

Introduction

The mechanosensitive ion channel, Piezo1, is responsible for transducing mechanical stimuli into intracellular biochemical signals and has been identified within periodontal ligament cells (PDLCs). Nonetheless, the precise biologic function of Piezo1 in the regulation of alveolar bone remodeling by PDLCs during compressive forces remains unclear. Therefore, this study focused on elucidating the role of the Piezo1 channel in alveolar bone remodeling and uncovering its underlying mechanisms.

Methods

PDLCs were subjected to compressive force and Piezo1 inhibitors. Piezo1 and β-catenin expressions were quantified by quantitative reverse transcription polymerase chain reaction and Western blot. The intracellular calcium concentration was measured using Fluo-8 AM staining. The osteogenic and osteoclastic activities were assessed using alkaline phosphatase staining, enzyme-linked immunosorbent assay, quantitative reverse transcription polymerase chain reaction, and Western blot. In vivo, orthodontic tooth movement was used to determine the effects of Piezo1 on alveolar bone remodeling.

Results

Piezo1 and activated β-catenin expressions were upregulated under compressive force. Piezo1 inhibition reduced β-catenin activation, osteogenic differentiation, and osteoclastic activities. β-catenin knockdown reversed the increased osteogenic differentiation but had little impact on osteoclastic activities. In vivo, Piezo1 inhibition led to decreased tooth movement distance, accompanied by reduced β-catenin activation and expression of osteogenic and osteoclastic markers on the compression side.

Conclusions

The Piezo1 channel is a key mechanotransduction component of PDLCs that senses compressive force and activates β-catenin to regulate alveolar bone remodeling.

Highlights

•

Compression force activated the Piezo1 channel in periodontal ligament cells (PDLCs).
•

Piezo1 regulates the osteogenic and osteoclastic activities of PDLCs under compression.
•

Piezo1 regulated the osteogenic differentiation of PDLCs via β-catenin under compression.
•

Piezo1 is critical for bone remodeling on the compressed side during tooth movement.

Orthodontic therapy aims to correct mispositioned teeth through the remodeling of the periodontium, encompassing the periodontal ligament (PDL), cementum, and alveolar bone. The periodontal tissue senses the mechanical forces exerted on teeth and converts those forces into intracellular biochemical signals. This signaling cascade allows the periodontal tissue to undergo cellular- and molecular-level remodeling, characterized by simultaneous bone resorption on the pressure side and new bone formation on the tension side. Effective tooth movement depends on ordered bone remodeling activity dominated by osteoclastic activity on the compression side. Disruption of this remodeling can lead to side effects, including apical root resorption and periodontal inflammation. Cellular responses to the mechanical environment and mechanotransduction pathways are integral to ensure efficient and safe orthodontic treatment. However, the underlying biomechanical and biologic mechanisms of orthodontic tooth movement (OTM) on the compression side remain incompletely understood. Therefore, investigating these mechanisms would contribute to the attainment of optimal orthodontic outcomes.

The PDL is a fibrous tissue that connects the tooth root and alveolar bone, and plays an essential role in the sensing and conversion of mechanical force during OTM. PDL cells (PDLCs), also known as PDL fibroblasts, are the most prevalent cell type in the PDL and the main functional component thereof. PDLCs are highly sensitive to mechanical stimuli and play a key role in mechanical force transduction during OTM. Mechanosensory and mechanotransduction pathways are activated in PDLCs after the application of orthodontic forces, leading to the conversion of mechanical stimuli into biochemical signals. PDLCs on the compression side produce various inflammatory and remodeling compounds, including prostaglandins, leukotrienes, receptor activators of nuclear kappa b ligand (RANKL), interleukin-1, interleukin-6, and tumor necrosis factor α. They also increase the ratio of RANKL to osteoprotegerin (OPG), resulting in increased osteoclast differentiation and bone resorption, ultimately leading to tooth movement. Despite the established role of PDLCs in regulating alveolar bone remodeling during OTM, further exploration is necessary to understand the specific mechanisms of PDLCs’ mechanotransduction process.

In 2010, a novel class of mechanosensory ion channels called the Piezo family was discovered, with a high affinity for calcium and classified into 2 subtypes: Piezo1 and Piezo2. ^, Piezo1 channels are distributed widely in bone tissue and are related to bone remodeling and development and skeletal diseases. Research has indicated that Piezo1 expression can be increased by mechanical loading and that it subsequently promotes bone anabolism and formation. In mice, conditional deletion of Piezo1 in osteoblasts and osteocytes disrupts osteogenesis, reducing bone mass and strength. Conversely, the administration of a Piezo1 agonist to adult mice increases bone mass. Intriguingly, recent studies have reported the expression of Piezo1, among other mechanically gated channels, on PDLCs. Available in vitro studies suggest that the Piezo1 channel on PDLCs may transform mechanical stimuli into intracellular biochemical and biophysical signals via calcium influx and subsequently regulate downstream intracellular signaling pathways, including Notch, ERK, and NF-κB. ^, ^, Based on this evidence, it is reasonable to speculate that the Piezo1 channel may serve as a crucial mechanosensor on PDLCs, regulating alveolar bone remodeling in response to mechanical stimuli.

The Wnt/β-catenin pathway is capable of detecting mechanical stimuli and responding through various processes such as cell division, cell proliferation, and differentiation. ^, Prior research has established the involvement of the Wnt/β-catenin pathway in alveolar bone remodeling during OTM, wherein it regulates the expression of an osteoblastic gene and participates in osteoclastogenesis through modulation of OPG/RANKL ratio. ^, These findings suggest that the Wnt/β-catenin pathway could act as a downstream signal of PDLCs during mechanotransduction, although such a proposition remains to be substantiated. Notably, recent studies have reported that the activation of Piezo1 may enhance the expression and nuclear localization of β-catenin in a Yes-associated protein-dependent manner, resulting in upregulation of osteogenic, chondrogenic, and angiogenic factors. ^, ^, These results suggest that the Piezo1-mediated mechanotransduction in PDLCs could be modulated through the Wnt/β-catenin signaling.

Based on the evidence presented, we hypothesize that the Piezo1 channel is a critical mechanotransduction component located on the membrane of PDLCs, facilitating the transduction of mechanical stimuli and subsequent activation of the downstream Wnt/β-catenin signaling cascade, thereby initiating tissue remodeling in response to OTM. This investigation primarily focused on the mechanistic role of Piezo1 on the compression side and employed both in vivo and in vitro methodologies to test the hypothesis.

Material and methods

Human PDLCs (hPDLCs) were obtained from premolars that were extracted for orthodontic treatment at the Hospital of Stomatology Sichuan University. All procedures were approved by the research ethics committee of the State Key Laboratory of Oral Diseases in Chengdu, China (WCHSIRB-D-2021-539). Briefly, the PDL was scraped from the mid-third of the root surfaces and transferred to a T-25 plastic culture flask with a growth medium containing α-MEM, 20% fetal bovine similar, penicillin, and streptomycin. Cells from passages 3-6 were used for experiments ( Supplementary Fig 1 ).

The hPDLCs were subjected to the static compressive force (CF) of glass plates with a defined weight of 1.5 g/cm ² , as described previously ( Fig 1 , A ). The effects of CF on the expression of Piezo1 were investigated after 0, 3, 6, 12, 24, and 48 hours of stress loading. To study the effects of Piezo1 on osteogenic differentiation and osteoclastic activities under compression force, 4 distinct groups were established: the control (CON) group with no intervention; the inhibitor (INH) group received Piezo1 inhibitor GsMtx4 (2.5 uM; Abcam, San Francisco, Calif); the CF group received CF (1.5 g/cm ² ), and the INH + CF group with both interventions. After force application for 6 and 12 hours, cells were collected for further analysis.

PDLCs were seeded and cultured in observation dishes specified for confocal laser microscopy (CLSM) to detect the effect of CF on the expression of Piezo1 on the basis of currently published approaches. The primary antibody against Piezo1 (1:200; Abcam, San Francisco, Calif) was incubated at 4°C overnight. A secondary antibody conjugated to AlexaFluor647 (ab150075, Abcam) was used to incubate the samples for 2 hours. 4,6-diamino-2-phenyl indole (DAPI; D9542; Sigma-Aldrich, St Louis, Mo) and phalloidine (6 μmol/L; Invitrogen, Carlsbad, Calif) were applied to stain the nuclei and cytoskeleton. The cells were observed with CLSM (FV-3000; Olympus, Tokyo, Japan). All experiments were repeated at least 3 times.

To verify the effects of Piezo1 inhibitor GsMTx4 on the Piezo1 channel, intracellular calcium concentrations of PDLCs were examined among different groups. After 6 and 12 hours of stress loading, cells were treated with 1 μM Fluo-8AM (21081; AAT Bioquest, Sunnyvale, Calif) for 20 minutes in the dark and observed by CLSM. The fluorescence intensity was measured using Image Pro Plus software (version 6.0; Media Cybernetics, Rockville, Md).

To study the effects of Piezo1 on mRNA expression in hPDLCs under compression force, total RNA was extracted from PDLCs after 6 and 12 hours of mechanical loading using Trizol reagent (Invitrogen), SuperScript III cDNA Synthesis Kit (Invitrogen) and SYBR Premix Ex TaqTM kit (Takara Bio, Shiga, Japan) according to the manufacturer’s instructions. All used primers were gene-specific and intron-flanking ( Table ).

Table

Sequences of primers used in RT-PCR

Gene	Forward primer sequence (5’-3’)	Reverse primer sequence (5’-3’)
GAPDH	TCAGCAATGCCTCCTGCAC	CCAGGAAATGAGCTTGACAAA
Piezo1	TGGAGGAGGCTGGCATCATCTG	GCAGGTAGTAATGGCTAAGGAAGACG
RUNX2	AGGCAGTTCCCAAGCATTTCATCC	TGGCAGGTAGGTGTGGTAGTGAG
OSX	CTGCTTGAGGAGGAAGTTCACTATGG	TGCTTTGCCCAGAGTTGTTGAGTC
RANKL	TTACCTGTATGCCAACATTTGC	TTTGATGCTGGTTTTAGTGACG
OPG	GAAACGTTTCCTCCAAAGTACC	CTGTCTGTGTAGTAGTGGTCAG
β-catenin	GAGGAGATGTACATTCAGCAGA	GTTGACCACCCCTGCATAG

GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

After 6 and 12 hours of mechanical loading, total protein was extracted from cell samples, and Western blots were conducted to examine the effects of Piezo1 on protein expression of hPDLCs under compression force. Detailed procedures have been described previously. The primary antibodies used in this study were rabbit anti-Piezo1 and active β-catenin from Abcam; β-catenin, Runt-related transcription factor 2 (RUNX2), Osterix (OSX), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) from Huabio. The intensity of each band was quantified using Image-J software (NIH, Bethesda, Md) after normalization to GAPDH.

Alkaline phosphatase (ALP) staining was performed to evaluate the mineralization capacity of PDLCs after 24 hours of mechanical loading. We used the ALP Activity Assay Kit (Beyotime, Shanghai, China) and followed the manufacturer’s recommended protocol. The reaction outcomes were observed through an optical microscope (IX71; Olympus, Tokyo, Japan). To obtain quantitative data, cells were lysed with ultrasound, and supernatants were collected for ALP determination using the Quantitative ALP Assay Kit (Beyotime). The optical density was measured at 405 nm.

Enzyme-linked immunosorbent assay kits of RANKL and OPG were used according to the manufacturer’s instructions. Protein expression per well was related to the respective number of PDLCs, which was counted with a Beckman Coulter Counter (Irving, Tex).

To verify whether the Wnt/β-catenin pathway was the downstream signaling pathway of Piezo1, small interfering RNA (siRNA) interference was adopted to silence β-catenin. siRNA against β-catenin (duplex sequences: AGCUGAUAUUGAUGGACAG) and scrambled siRNA were purchased from Hanbio Biotechnology (Shanghai, China). PDLCs were transfected with scrambled or target siRNA using Lipofectamine 3000 (Invitrogen).

An animal study was conducted to investigate the effects of Piezo1 on OTM. All animal experiment procedures were approved by the Research Ethics Committee of the State Key Laboratory of Oral Diseases in Chengdu, China (WCHSIRB-D-2021-617). A total of 60 male Wistar rats aged 8 weeks (body weight, 200 ± 10 g) were obtained from the experimental animal center of Sichuan University. Then, the animals were randomly divided into 3 groups of 20 animals each: OTM group, OTM + INH, and CON group. The OTM animal model was established as described previously. Briefly, a nickel-titanium coil spring (3M Unitek, Monrovia, Calif) was fixed between the maxillary left first molar and the incisors to generate a force of 40 g. The rats in the OTM and OTM + INH groups received orthodontic appliances, and the CON group did not receive the appliance. The animals in the OTM + INH group received a subcutaneous injection of Piezo1 inhibitor GsMTx4 (Abcam) at a dosage of 20 μL with a concentration of 10 μM every other day, whereas the OTM and CON group received only the vehicle. Six rats of each group were killed immediately on day 0 (the day before orthodontic force application) to serve as negative controls and on 3, 7, and 14 days after tooth movement. Alveolar bone blocks, including the left first molars, were harvested for further analysis.

To observe the changes in trabeculae and bone density on 3, 7, and 14 days after tooth movement, a high-resolution micro-CT 50 system (Scanco Medical, Bassersdorf, Switzerland) was used. Scanning of the specimens was carried out at 70 kV and 114 mA, with an integration time of 500 milliseconds and a voxel resolution of 10 μm. The amount of OTM was determined by the smallest distance between the crowns of the first and second molar. The parameters, including the bone-to-total volume (BTV) ratio, trabecular spacing (Tb.Sp), trabecular number (Tb.N), and trabecular thickness (Tb.Th) were calculated.

After microcomputed tomography (micro-CT) scanning, the left half maxilla of each animal was decalcified, dehydrated, and embedded in paraffin. Next, all the samples were excised into 5μm-thick frontal sections in the sagittal direction. Tartrate-resistant acid phosphatase (TRAP) staining (Sigma-Aldrich, St Louis, Mo) was performed for histologic analyses. Immunofluorescence (IF) staining was performed as previously described. Polyclonal primary antibodies of rabbit anti-Piezo1 (Abcam, 1:200) were adopted. The stained sections were observed by fluorescent microscopy (DMI 6000; Leica, Wetzlar, Germany). For Immunohistochemistry (IHC) staining, sections were incubated with primary antibodies: OPG, RUNX2, OSX, and β-catenin from Huabio (Hangzhou, China) and RANKL and active β-catenin from Abcam (San Francisco, Calif). Slides were counterstained with hematoxylin and viewed using a light microscope (Eclipse 80i; Nikon, Toyko, Japan). Quantitative analyses of IF and IHC images were done using Image-Pro Plus software (version 6.0; Media Cybernetics, Rockville, Md).

Statistical analysis

GraphPad Prism software (version 7; GraphPad, San Diego, Calif) was used for statistical analysis. Data were expressed as the mean ± standard deviation from at least 3 independent experiments. The statistical difference among groups was analyzed by 1-way analysis of variance analysis followed by the Student–Newman–Keuls methods of analysis of variance. P < 0.05 was considered statistically significant.

Results

Static compressive stress was applied to PDLCs as shown in Figure 1 , A . IF showed that the expression of Piezo1, which is mainly located in the membrane and cytoplasm of PDLCs, increased in the early stage and gradually decreased after 12 hours of mechanical loading ( Figs 1 , B and C ; Supplementary Fig 2 ). Quantitative reverse transcription polymerase chain reaction and Western blotting results confirmed that both mRNA and protein levels of Piezo1 reached their maximum at 12 hours of compression force (2.9-fold for mRNA and 1.8-fold for protein compared with 0 hours), followed by a gradual decline ( Figs 1 , D and E ). As a nonselective cation channel, Piezo1’s activation triggers calcium ion influx. To further examine the effects of Peizo1 on intracellular calcium ion concentration under stress stimulus in PDLCs, a Piezo1-specific inhibitor GsMtx4 was applied. Calcium ion fluorescence imaging and semiquantitative analysis demonstrated that compressive stress significantly increased the intracellular calcium concentration of PDLCs in the CF group, which was effectively reduced by the application of GsMTx4. However, even with the inhibitor, the calcium concentration was still higher than that of the CON group. ( Fig 1 , F ). These findings confirmed the activation of the mechanosensitive cation channel Piezo1 by compressive stress in PDLCs, as evidenced by increased calcium influx. These results suggested that Piezo1 plays a critical role in mediating the response of PDLCs to compressive stress.

The Piezo1 channel inhibitor GsMTx4 was used to investigate the role of Piezo1 in bone metabolism under compressive stress in PDLCs. Quantitative reverse transcription polymerase chain reaction assays showed that GsMTx4 treatment had no significant effect on the expressions of key osteogenic transcription factors RUNX2 and OSX in PDLCs without compressive stress stimulation. However, under compressive stress, mRNA and protein levels of RUNX2 and OSX significantly increased in the CF group compared with in the CON group but were significantly decreased in the INH + CF group to levels similar to those in the CON group. ( Figs 2 , A – F ). The ALP activity in the CF group was also significantly increased compared to the CON group and was significantly decreased in the INH + CF group ( Fig 2 , G ).